9slopez2 9slopez2

04-02-2020
Mathematics

contestada

how do you know if two fractions are equivalent?

Respuesta :

bhulbergp445br bhulbergp445br

04-02-2020

How??? I don’t know the answer sorry

Answer Link

Otras preguntas

. Find the approximate length of the hypotenuse of a right triangle with leg lengths 8.4 cm and 7.6 cm. 4.00 cm 7.99 cm 5.66 cm 11.33 cm

Name the five transport mechanisms of the cell:

zach has 8 stores that he manages 6 of those stores are hiring what fraction of his stores are hiring?

Simplify the expression completely. x squared over x to the power of 6

6. Delete any base (between the READING FRAME, excluding the start and stop codons) and show the change in the amino acid sequence 5’ agcgggatgagcgcatgtggcgcat

Please help ASAP!!!! 100 points!

The reason why vanessa did not include sports skills activities in her program was that she:

Make w the subject of Y-aw=2w-1

The vessels that are responsible for carrying blood away from the heart are

Write the equation of the line containing the point (1 2) and parallel to the line 2x + 4y = 1